pCas-Guide載體說明 Cas9 based genome editing has become a popular tool for targeted genome manipulation
because of its simplicity and high cutting efficiency. This system requires a functional cas9
protein and a guide RNA for effective double-stranded breakage at a desired site. OriGene has
developed the pCas-Guide system, a dual-function vector with both guide RNA and Cas9
expression. OriGene also designed a set of donor cassettes for construction of donor vectors.
These include Luciferase-Loxp-Puro-Loxp, tGFP-Loxp-Puro-Loxp and tRFP-Loxp-BSD-Loxp.
The pCas-Guide vector is designed for cloning a guide RNA insert for genome editing purpose.
The vector also has a CMV-driven codon-optimized Cas9. When co-transfected with a proper
donor DNA, targeted genome editing can be achieved. The vector retains the ampicillin
resistance gene for the selection of E. coli transformants. The vector is supplied as a precut
vector, ready for insert ligation. This system has been successfully validated in multiple cases of
genome editing. 實(shí)驗(yàn)操作 I. Design target sequence
OriGene has developed a proprietary Cas9 guide RNA designing tool which is free to use,
http://www.blueheronbio.com/. Follow the instructions below to design your guide RNA:
1. Select your desired Cas9 cutting site from your genomic region of interest.
2. Copy around 100 bp of genomic sequence flanking the cutting site (-50 to +50).
Paste the sequence to the sequence box and click the Search button.
3. The program will return all possible targeting sequences with location and GC
content obtained from searching both the plus and minus strands. If there is no
target returned, expand your genomic region of interest (-100 to +100) and
search again until there is a positive return.
4. Select a few target sequences to Blast against the genomic DNA database to
check sequence specificity.
5. Select 2 to 3 target sequences to clone into pCas-Guide vector
II. Addition of extra bases to the ends of the target sequence
To facilitate cloning of the 20-bp target sequence, extra bases need to be added to the ends.
1. Select a desired 20-bp sequence as a target. The following is an example sequence:
Forward sequence: 5’ ATGGGAGGTGGTATGGGAGG 3’
Reverse complement sequence: 5’ CCTCCCATACCACCTCCCAT 3’
2. Add ‘gatcg’ to the 5’ end of the forward sequence and ‘g’ to its 3’ end. The final
sense oligo in this example will be
5’ gatcgATGGGAGGTGGTATGGGAGGg 3’
3. Add ‘a(chǎn)aaac’ to the 5’ end of reverse complementary sequence and ‘c’ to its 3’
end. The final reverse complementary sequence is
5’ aaaacCCTCCCATACCACCTCCCATc 3’
The two oligos should anneal to form the following double strand:
4. Order the two final oligos from a commercial oligo provider, such as IDT.
III. Cloning the double-stranded oligos into the pCas-Guide vector
1. Anneal the oligos to form double-stranded duplexes
In a PCR tube, add the following:
2 μL Forward oligo (100 μM stock)
2 μL Reverse oligo (100 μM stock)
4 μL 10X annealing buffer
32 μL dH2O
Mix the solution and follow the steps to anneal the oligos in a PCR machine:
940C for 4min
750C for 5 min
650C for 15 min
250C for 20 min
After annealing, transfer the solution to a 1.5 mL tube and add 360 μL of dH2O.
The double-stranded oligo DNA is ready for ligation.
2. Ligation and transformation
A. Prepare the ligation according to the following protocol
Component Volume
10x Ligation buffer 1 μL
Precut pCAS-Guide vector (10 ng/ μL) 1 μL
Annealed double-stranded oligos (diluted from step 1) 1 μL
Ligase (0.5 u/ μL, Weiss unit) 0.5 μL
dH2O 6.5 μL
Total Volume 10 μL
B. Mix the solution and incubate the tube at 22 to 370C or room temperature for two
hours according to the manufacturer’s recommendation.
C. Add 1 μL of the ligation mixture to 10 μL of competent cells (efficiency rated > 106
cfu/μg DNA) on ice. Do the transformation according to the manufacturer’s protocol.
For chemically competent cells, follow steps D-E.
D. Mix the tube gently and keep it on ice for 25 minutes.
E. Heat shock the tube for 30 seconds at 420C.
F. Put the tube on ice for 2 minutes, then add 500 μL LB or SOC medium.
G. Rock the tube gently at 370C for 1 hour.
H. Spread 50 μL of the E. Coli cells on an LB ampicillin-agar plate.
I. Centrifuge the remaining E. Coli cells at 5K rpm for 5 minutes. Discard the majority of
the supernatant (around 50 μL supernatant left) and resuspend the cell pellet in the
remaining liquid. Spread all the E. Coli cells on a separate LB ampicillin-agar plate.
J. Incubate the two plates at 370C for 16 hours to allow colony formation.
3. Screening colonies
In a typical subcloning ligation, at least 95% of the colonies should contain the desired
insert. Pick 6 to 10 colonies into 5 mL LB-ampicillin culture each, and culture overnight.
Perform DNA purification using a mini-prep kit from OriGene,
http://www.origene.com/Other/Plasmid_Purification/ . Sequence the purified DNA and
analyze the sequencing data to identify a correct clone for proper insert identification and
orientation.
